Scopus 2020
Permanent URI for this collectionhttps://repository.li.mahidol.ac.th/handle/20.500.14594/49501
Browse
Recent Submissions
Publication Metadata only Sustainable development: Gender equality as corporate social responsibility by mining companies(2020-01-01) Nattavud Pimpa; Mahidol UniversityCopyright © 2020 Inderscience Enterprises Ltd. The gendered impacts of mining industry on women is critical for mining companies. A key challenge for the management of sustainable development programs for gender equality is the need to develop sophisticated approaches that work at the local and international levels. In this paper, the researcher investigates the impact of CSR programs on women through the perceptions and life experiences of female workers and various members of the mining community in La PDRs. The results show that CSR programs on women employment, social roles of women in the organisation, health promotion, and vocational training can influence the likelihood of sustainable development by mining companies. However, the extent to which mining companies can be considered focus and accountable development agents remains limited due to the instrumental nature of development-oriented CSR programs.Publication Metadata only Circular economy approach for wastewater treatment farming in Bangpakong River basin(2020-12-09) N. Surinkul; S. Threedeach; W. Chiemchaisri; C. Chiemchaisri; Kasetsart University; Mahidol University; Suan Dusit University© 2020 Published under licence by IOP Publishing Ltd. Bangpakong River is one of river basins that faced the pollution problem in Thailand. This river is located in the downstream of central pain of Thailand and flows into the sea at the gulf of Thailand. Water quality problems in the last decade of this river basin are appeared from the low water quality index with evidences such as dead of fish, black color of water, low Dissolved Oxygen (DO) concentrations, high organics and nutrients concentrations, high contaminated of coliform bacteria. All wastewater is controlled by the environmental law. Only wastewater from agriculture part is not yet properly managed. The objective of this study was to quantify the mass and material flows in agricultural farms such as pig, fish and prawn farms. Circular economy concept as reuse of wastewater in agricultural farms was approached in scenario. Surveys, questionnaires and water samplings were taken for farms. Information and mass flows within the farms were analyzed. This study found that the main source of pollution from these farms mostly resulted from the effluent of wastewater in term of Biological Oxygen Demand (BOD) and Total Nitrogen (TN) loads, were discharged into the environment. The hot spot areas were canals which flow to the river. Mass flows in pig farm revealed that BOD and TN loads to the environment were 90, and 120 tons/year. In which, calculated thresholds were 30 and 60 tons/year for BOD and TN. Similar results also found from aquaculture farms which contributes BOD and TN loads of 187 and 77 tons/year for fish farms and 156 and 84 tons for prawn farms. In this study, calculated reuse as circular economy approach about 50% of farm wastewater to agricultural field could provide the key role of BOD and TN reduction to the environment, and meeting the threshold level.Publication Metadata only JITBot: An Explainable Just-In-Time Defect Prediction Bot(2020-09-01) Chaiyakarn Khanan; Worawit Luewichana; Krissakorn Pruktharathikoon; Jirayus Jiarpakdee; Chakkrit Tantithamthavorn; Morakot Choetkiertikul; Chaiyong Ragkhitwetsagul; Thanwadee Sunetnanta; Monash University; Mahidol University© 2020 ACM. Just-In-Time (JIT) defect prediction is a classification model that is trained using historical data to predict bug-introducing changes. However, recent studies raised concerns related to the explain-ability of the predictions of many software analytics applications (i.e., practitioners do not understand why commits are risky and how to improve them). In addition, the adoption of Just-In-Time defect prediction is still limited due to a lack of integration into CI/CD pipelines and modern software development platforms (e.g., GitHub). In this paper, we present an explainable Just-In-Time defect prediction framework to automatically generate feedback to developers by providing the riskiness of each commit, explaining why such commit is risky, and suggesting risk mitigation plans. The proposed framework is integrated into the GitHub CI/CD pipeline as a GitHub application to continuously monitor and analyse a stream of commits in many GitHub repositories. Finally, we discuss the usage scenarios and their implications to practitioners. The VDO demonstration is available at https://jitbot-tool.github.io/.Publication Metadata only Toad poisoning: Clinical characteristics and outcomes(2020-01-01) Satariya Trakulsrichai; Kritsada Chumvanichaya; Charuwan Sriapha; Achara Tongpoo; Winai Wananukul; Faculty of Medicine, Ramathibodi Hospital, Mahidol University; Somdech Phra Pinklao Hospital© 2020 Trakulsrichai et al. Objective: This study was performed to describe the clinical characteristics and outcomes of patients with toad poisoning in Thailand. Methods: We carried out a retrospective study of patients with toad poisoning from the Ramathibodi Poison Center Toxic Exposure Surveillance System during a 5-year period (2012–2016). Results: We studied 36 patients poisoned by toad toxin. The median age was 31 years. Most patients were male (66.7%) and had ingested toad meat (50%). The most common presentation was gastrointestinal (GI) symptoms with a median onset of 2 h after ingestion. Twelve patients presented with bradycardia; seven presented with shock and one with cardiac arrest. In the initial EKGs of all patients, the most common abnormality was sinus bradycardia.Two patients developed cardiac arrest early during management in the emergency room (within 15 minutes after ER arrival or within 4.5 h after ingestion). During admission, one patient developed sinus bradycardia, and two developed bradyarrhythmia; however, all three were stable. No tachyarrhythmias such as ventricular tachycardia were detected in any patient. Some patients (11.1%) presented with hyperkalemia. Serum digoxin was detected in five of seven patients tested, ranging from 0.43 to >8 ng/mL. Most patients (75%) were admitted to the hospital; the median duration of hospitalization was 2 d (range 0.5–5 d). The overall mortality rate was 8.3%, and all three patients that died ate toad meat and/or eggs and developed cardiac arrest. All patients received supportive with/without symptomatic care including GI decontamination, inotropic drugs, cardiac pacing, and management of hyperkalemia. One patient received intravenous calcium for hyperkalemia but did not develop dysrhythmia after calcium administration. One patient received digoxin-specific antibody fragments (DsFab), after which he clinically improved and was discharged. Conclusion: Toad poisoning commonly caused GI symptoms and bradycardia. However, in severe cases, death occurred. Tachyarrhythmia was not observed. Supportive, symptomatic care might be the main therapies for this poisoning, especially if DsFab is not available.Publication Metadata only Chitin and Chitosan Derivatives as Biomaterial Resources for Biological and Biomedical Applications(2020-12-16) Saravut Satitsri; Chatchai Muanprasat; Mahidol UniversityChitin is a long-chain polymer of N-acetyl-glucosamine, which is regularly found in the exoskeleton of arthropods including insects, shellfish and the cell wall of fungi. It has been known that chitin can be used for biological and biomedical applications, especially as a biomaterial for tissue repairing, encapsulating drug for drug delivery. However, chitin has been postulated as an inducer of proinflammatory cytokines and certain diseases including asthma. Likewise, chitosan, a long-chain polymer of N-acetyl-glucosamine and d-glucosamine derived from chitin deacetylation, and chitosan oligosaccharide, a short chain polymer, have been known for their potential therapeutic effects, including anti-inflammatory, antioxidant, antidiarrheal, and anti-Alzheimer effects. This review summarizes potential utilization and limitation of chitin, chitosan and chitosan oligosaccharide in a variety of diseases. Furthermore, future direction of research and development of chitin, chitosan, and chitosan oligosaccharide for biomedical applications is discussed.Publication Metadata only The experiential learning unit for promoting students’ understanding of vapor pressure and related concepts(2020-01-01) Siwa Mahardthai; Supan Yodyingyong; Namkang Sriwattanarothai; Piyachat Jittam; Mahidol University© 2020, Springer Nature Singapore Pte Ltd. Vapor pressure is a difficult concept for high school students because it requires understanding at the microscopic level. To better understand the concept, students should clearly understand some prerequisite concepts, such as evaporation, condensation, and pressure. Therefore, this research aims to develop Kolb’s experiential learning activities for providing experience before extending to learn the vapor pressure concept through online resources. The learning unit consists of two main activities that are 1) observing scientific phenomena aims at helping students to gain experience of the concepts, and 2) color manipulatives designing to help students to understand the concepts at the microscopic level. The learning unit had been implemented with grade ten students. The conceptual test and interview had been used to assess student understanding. Results show that some students still have learning difficulties related to vapor pressure and related concepts. They had difficulty in explaining the concepts at the molecular explanation and confused some technical terms. The online resources have been discussed for suggesting a suitable pathway to each group of students.Publication Metadata only Improving accuracy of an AoA-based Wi-Fi indoor localization using kalman filter(2020-11-04) Boonsit Yimwadsana; Vichhaiy Serey; Mahidol UniversityCopyright © JCSSE 2020 - 17th International Joint Conf. on Computer Science and Software Engineering. Indoor location-based system (Indoor LBS) has increasingly attracted attentions in research and industrial community in the recent years. However, the adoption of indoor LBS is still slow due to many obstacles, in particular, its low accuracy performance. Many real-world applications require challenging performance targets such as real-time operation, high accuracy, and energy efficiency. In order to meet the requirements, fast and accurate positioning methods are necessary. However, noise from interference and multipath in the indoor environment is one of the most important factors preventing accurate and stable positioning. Since it is difficult to make changes to the sensor technologies especially in the hardware, improving the accuracy of indoor positioning by removing noise from the positioning measurement offers an effective solution to the accuracy problem for indoor LBS. We propose a Kalman Filter method which could be applied to the measurements of the indoor LBS. The result from the experiment shows that the positioning accuracy has improved for over 40 percent for static positioning.Publication Metadata only Turbulent pattern in the 1,4-cyclohexanedione Belousov-Zhabotinsky reaction(2020-12-28) Suparinthon Anupong; Igor Schreiber; On Uma Kheowan; University of Chemistry and Technology, Prague; Mahidol University© 2020 the Owner Societies. Chemical turbulence was observed experimentally in the 1,4-cyclohexanedione Belousov-Zhabotinsky (CHD-BZ) reaction in a double layer consisting of a catalyst-loaded gel and uncatalyzed liquid on a Petri dish. The chemical patterns in the CHD-BZ reaction occur spontaneously in various forms as follows: The initial, regular, transient, and turbulent patterns, subsequently. These four patterns are characterized by using the two-dimensional Fourier transform (2D-FT). Mechanism of the onset of the turbulence in the CHD-BZ reaction is proposed. Turbulence in the CHD-BZ reaction is reproducible under a well defined protocol and it exists for a period of time of about 50 minutes, which is sufficiently long to offer a good opportunity to study and control the turbulence in the future. Two models of the BZ reaction were used to simulate the spiral breakup. Both are capable of producing spiral turbulence from initially regular patterns in each layer and reflect certain features of dynamics observed in experiments.Publication Metadata only Home-based chemotherapy for stage III colon cancer patients in Thailand: Cost-utility and budget impact analyses(2020-01-01) Nattanichcha Kulthanachairojana; Phichai Chansriwong; Nintita Sripaiboonkij Thokanit; Suwannee Sirilerttrakul; Nopakan Wannakansophon; Suthira Taychakhoonavudh; Chulalongkorn University; Faculty of Medicine, Ramathibodi Hospital, Mahidol University© 2020 The Authors. Cancer Medicine published by John Wiley & Sons Ltd. Home-based chemotherapy (HC) is a new treatment alternative to hospital-based chemotherapy treatment (IP) and is administered via portable intravenous pumps at the patient's home. HC reduces the demand for inpatient bed capacity in hospitals and reduces the cost of an infusion. This study takes a societal perspective while conducting the cost-utility and budget impact analyses (BIA) of HC and IP with an mFOLFOX6 regimen on patients with stage III colon cancer. We conducted a cost-utility analysis with a 6-month time horizon. The parameter inputs for the model were gathered from a retrospective cohort study on patients diagnosed with stage III colon cancer at Ramathibodi Hospital, Bangkok. The resource usage of HC and IP was determined based on medical records. The per-unit direct medical, home health service, and adverse events (AE) management costs were gathered from the standard cost list. The health outcome of treatment was measured in terms of quality-adjusted life years. Disutility related to AE was calculated. We conducted a sensitivity analysis for the uncertainty results and performed BIA based on the societal perspective on a 1-year time horizon. HC provided a cost-saving of $1,513.37 per patient for the period of treatment. Thus, assuming 526 patients per year, the use of HC could achieve a cumulative annual cost-saving of $828,436. HC is a cost-saving strategy compared to IP for stage III colon cancer treatment. We recommend that the service reimbursement should include national standardization in chemotherapy regimens as well as practice guidelines and protocols to prevent serious AEs.Publication Metadata only MmWave Path loss Prediction Model Using Grey System Theory for Urban Areas(2020-11-18) Supachai Phaiboon; Pisit Phokharatkul; Kasem Bundit University; Mahidol University© 2020 IEEE. This paper presents path loss prediction for 5G millimeter wave (mmWave) using grey model. The grey system theory is a computational method and used for an empirical model. The proposed model consists of a distance variable input and a path loss variable output. The path loss model was trained with measured path loss data at frequencies of 28 GHz. The proposed model is compared with four 5G empirical models, namely 5GCM, 3GPP, METIS and mmMAGIC. The results show that the single proposed model provide the prediction both LOS and NLOS with minimum MAE.Publication Metadata only Study on organic acid and anti-oxidant properties of Elaeagnus latifolia L.(2020-12-08) C. Niwaspragrit; P. Ratanachamnong; M. Munyanont; R. Deewatthanawong; Thailand Institute of Scientific and Technological Research (TISTR); Mahidol University© 2020 International Society for Horticultural Science. All rights reserved. Bastard oleaster (Elaeagnus latifolia Linn.) is an indigenous fruit tree growing in many areas of Thailand, especially northern and northeastern regions. The fruit contains vitamins and minerals with nutritional value; while, medicinal applications include the use of unripe fruit as an astringent and ripe fruit as a laxative. Organic acid contents, sugars, total polyphenol contents, and anti-oxidation properties of bastard oleaster fruit collected from 16 clones growing in Loei and Nong Khai Provinces were investigated. Comparisons were made between orange fruit in the early ripening stage and red fruit in the fully ripened stage. Organic acids as malic, tartaric, and citric were found in both stages, with higher contents in the early ripening stage. Sugar contents of glucose and mannose were higher in the early ripening stage; while, fructose and sucrose were higher during the fully ripened stage. Total polyphenol contents and anti-oxidation properties were higher in the early ripening stage compared to the fully ripened stage. Results indicated that bastard oleaster fruit has outstanding anti-oxidation properties and high malic acid content, especially in the early ripening stage. Our findings provide basic information that can be utilized by the food and cosmetic industries.Publication Metadata only Effects of BA and NAA on shoot multiplication of Grammatophyllum speciosum Blume in vitro(2020-12-08) S. Samala; S. Taweerodjanakarn; J. Thipwong; K. Thammasiri; P. P. Chareonsap; Suratthani Rajabhat University; Mahidol University; Plant Genetic Conservation Project under the Royal Initiative of Her Royal Highness Maha Chakri Sirindhorn (RSPG)© 2020 International Society for Horticultural Science. All rights reserved. Grammatophyllum speciosum Blume is the largest orchid species in the world and has many medicinal properties. It is also listed in Appendix II of CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) because it is relatively rare in nature. The effects of N6-benzyladenine (BA) and α-naphthalene acetic acid (NAA) on shoot multiplication of Grammatophyllum speciosum Blume were investigated. The 2-mm diameter protocorms were cultured in Murashige and Skoog (MS) liquid and on agar medium supplemented with BA (0, 1, 2, and 4 mg L-1) and NAA (0, 0.5, and 1 mg L-1) for 8 weeks. The results showed that the MS liquid medium was more effective for shoot multiplications (shoot number, shoot height, and leaf number) compared to MS agar medium. The MS liquid medium supplemented with 2 mg L-1BA yielded the highest average shoot multiplication (44.20 shoots protocorm-1). The lowest average shoot multiplication was found in MS agar medium supplemented with 0.5 mg L-1NAA at 4.60 shoots protocorm-1Publication Metadata only In vitro propagation and callus induction of Hedychium longicornutum Griff. ex Baker using different explants(2020-12-08) R. Chuengpanya; N. Chuenboonngarm; K. Sakchaichanchol; A. Muangkroot; K. Thammasiri; Mahidol University© 2020 International Society for Horticultural Science. All rights reserved. Hedychium longicornutum Griff. ex Baker (Zingiberaceae) is an endemic plant of the Malay Peninsula. This plant has a high potential to develop into a new ornamental plant because of wonderful multicolor with an exotic form of its inflorescence. However, the limited number of H. longicornutum in nature cannot meet consumer demand. Therefore, this study aimed to establish an efficient in vitro H. longicornutum propagation method through organogenesis. For direct organogenesis, shoot tips and leafy-shoot bases were cultured on Murashige and Skoog (MS) gelrite medium supplemented with different concentrations of N6-benzyladenine (BA) or thidiazuron (TDZ), for 4 weeks. Then, explants were transferred onto PGRs-free MS gelrite medium for another 12 weeks. The results revealed that shoot regenerated from leafy-shoot bases showed a higher amount and height when compared to regenerated shoots from shoot tips in every culture medium. Leafy-shoot bases that had been cultured on MS gelrite medium supplemented with 4 mg L-1 BA generated a large number of new plants (14.00±1.05 shoots explant-1) with the longest shoot (14.21±0.37 cm). Plants regenerated from this medium spontaneously rooted and exhibited a survival rate at 85% after acclimatization for 4 weeks. In indirect organogenesis, this study firstly investigated a suitable callus condition before establishing the indirect H. longicornutum organogenesis method for further study. Leaves and leafy-shoot bases were cultured on Hedychium callus induction medium (HEDM) supplemented with various combinations of 2,4-dichlorophenoxy acetic acid (2,4-D) and kinetin (KN) under light and dark conditions. After 8 weeks, leaves failed to induce callus in all treatments. In contrast, leafy-shoot bases cultured on HEDM supplemented with 1 mg L-1 2,4-D and 2 mg L-1 KN under light condition induced callus at 100% with the highest callus fresh weight (1.78±0.37 g explant-1). The information from this study will be a useful tool for mass-rapid in vitro multiplication of H. longicornutum, a valuable plant, on a commercial scale.Publication Metadata only Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis(2020-12-09) Supranee Thongpradit; Natini Jinawath; Asif Javed; Laran T. Jensen; Issarapa Chunsuwan; Kitiwan Rojnueangnit; Thipwimol Tim-Aroon; Krisna Lertsukprasert; Meng Shin Shiao; Nongnuch Sirachainan; Duangrurdee Wattanasirichaigoon; A-Star, Genome Institute of Singapore; Faculty of Medicine, Ramathibodi Hospital, Mahidol University; Mahidol University; Thammasat University; The University of Hong Kong© Copyright © 2020 Thongpradit, Jinawath, Javed, Jensen, Chunsuwan, Rojnueangnit, Tim-Aroon, Lertsukprasert, Shiao, Sirachainan and Wattanasirichaigoon. Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.Publication Metadata only Mobile learning technology in STEM education: A systematic review from 2010 to 2019(2020-11-23) Wacharaporn Khaokhajorn; Prapawan Thongsri; Patcharin Panjaburee; Niwat Srisawasdi; Sakon Nakhon Rajabhat University; Khon Kaen University; Mahidol UniversityCopyright © 2020 Asia-Pacific Society for Computers in Education. Mobile technology could support students' learning in anytime and anywhere. It led to mobile learning principle, which has been recognized as pedagogy to support the learning of Science, Technology, Engineering, and Mathematics (STEM). Recently, there is less systematic analysis to reveal trend of mobile learning in STEM education. This paper conducted a metareview of the studies published in academic journals, indexed by Scopus, from 2010 to 2019 to analyze years, nationalities, and subject areas emphasizing the pedagogy and technology of mobile learning in STEM education. The results revealed that the application of mobile learning technology in STEM disciplines have been increased in the past decade. In addition, the review articles reported subject areas in social science has the highest number of using mobile technology in STEM learning. The findings of this study encourage more educational research in the area of mobile learning technology in STEM education.Publication Metadata only Infodemic monikers in social media during covid-19 pandemic(2020-11-29) Jeevan Bhatta; Sharmistha Sharma; Shashi Kandel; Roshan Nepal; Mahidol University; The University of Adelaide; Prince of Songkla University; ThinkAloud Pvt. Ltd© 2020 Australasian College of Health Service Management. All right reserved. Social media is a common platform that enables its users to share opinions, personal experiences, perspectives with one another instantaneously, globally. It has played a paramount role during pandemics such as COVID-19 and unveiled itself as a crucial means to communicate between the sources and the individuals. However, it also has become a place to disseminate misinformation and fake news rapidly. Infodemic, a plethora of information, some authentic some not makes it even harder to general people to receive factual and trustworthy information when required, has grown to be a major risk to public health and social media is developing as a trendy platform for this infodemic. This commentary aims to explore how social media has affected the current situation. We also aim to share our insight to control this misinformation. This commentary contributes to evolving knowledge to counter fake news or health-related information shared over various social media platforms.Publication Metadata only Synthesis of calcium phosphate composite bioactive oleic acid-based gels and its application for dentine tubule occlusion(2020-01-01) Preeyaporn Harnkla; Orapin Chienthavorn; Khrongkhwan Akkarachaneeyakorn; Kasetsart University; Mahidol University© 2020 Trans Tech Publications Ltd, Switzerland. Dentine hypersensitivity (DH) is a common issue among humans caused by the erosion of tooth enamel as a result of chewing and brushing incorrectly. The most effective treatment method is occluding the exposed dentine tubules. Because calcium phosphate is an important mineral and the most common mineral for dentine and orthopaedic application, this study focuses on the synthesis of bioactive gels containing calcium phosphate nanoparticles. The synthesis is performed using water-in-oil emulsion and characterized by the use of TGA, Rheological, TEM, and SEM techniques. This method used oleic fatty acids as an external phase and Tween 20 as surfactant to form water-in-oil nanodroplets. Gelatine was used to form the substance into a gel and increase its stability. The resulting nanoparticles had the same spherical shape and a similar size. Therefore, the varying amounts of gelatin do not affect the particle size. However, viscoelastic properties of gels were found to be changed. The ability of the gel for dentine tubule occlusion was investigated using SEM techniques. After 1 day, it was found that the gels can occlude dentine tubules.Publication Metadata only Effects of Concentration and Temperature on Corrosion and Scale Inhibitive Behavior of Uncaria gambir Extract for Low-Carbon Steel in Cooling-Water Solution(2020-11-01) Jiraphan Pleanteangthume; Manthana Jariyaboon; Mahidol University© 2020, Allerton Press, Inc. Abstract: The corrosion inhibition property of the Uncaria gambir extract (UGE) for the low-carbon steel was investigated in a prepared cooling-water solution using gravimetric analysis and potentiodynamic polarization measurements. Anticorrosive effectiveness was tested at the UGE concentrations of 0–1500 ppm and temperatures of 40–60°C. The CaCO3 scale inhibition performance was evaluated following NACE standard TM 0374-2007 and ASTM D511-03. The surface morphology was analyzed by scanning electron microscopy. It was found that increasing the UGE concentration increased its anticorrosive effectiveness. A 70% corrosion inhibition efficiency and a 31% CaCO3 scale inhibition efficiency were observed during the use of 1500 ppm UGE. A change in the morphology of CaCO3 precipitate was observed due to the adsorption of the UGE, which suppressed the regular growth process. Increasing temperature decreased the effectiveness of the UGE. A higher corrosion potential and a reduction of anodic reactivity were also observed. The UGE acted as anodic inhibitor and conformed the Langmuir adsorption isotherm.Publication Metadata only An efficient in vitro plantlet regeneration of an ornamental aquatic plant Anubias heterophylla through shoot tip culture(2020-12-08) S. Rittirat; S. Klaocheed; K. Thammasiri; A. Walam; Nakhon Si Thammarat Rajabhat University; Mahidol University; Prince of Songkla University© 2020 International Society for Horticultural Science. All rights reserved. Anubias heterophylla is a commercially important ornamental aquatic plant species with traditional uses. Due to the low growth of plantlets, propagation by conventional means has been met with many difficulties. In this study, an efficient micropropagation protocol of a valuable ornamental aquatic plant, Anubias heterophylla, was developed successfully. Plant regeneration of Anubias heterophylla was achieved through organogenesis in shoot tip cultures. Multiple shoots were induced from cultured shoot tips on a MS (Murashige and Skoog, 1962) medium supplemented with 6-benzylaminopurine (BAP) and 1-naphthalene acetic acid (NAA). 100% of shoot regeneration frequency and 3.40±0.24 shoots explant-1 were achieved when cultured on a medium supplemented with 3.0 mg L-1 BAP. The multiple shoots formed vigorous growth on agar-gelled medium with well-developed leaves and roots after 60 days of culture. Acclimatization was done in a humid growth chamber for two weeks and the plantlets were gradually transferred to the greenhouse. More than 97% in vitro plants survived and grew vigorously without any morphological abnormalities during acclimatization in the greenhouse. The current protocol was the first reported on successful establishment of in vitro clonal propagation of A. heterophylla. This phytohormones and shoot tip explants based micropropagation can open up the route for in vitro clonal multiplication of this commercially important Anubias species.Publication Metadata only Water Level Detection from CCTV Cameras using a Deep Learning Approach(2020-11-16) Punyanuch Borwarnginn; Jason H. Haga; Worapan Kusakunniran; National Institute of Advanced Industrial Science and Technology; Mahidol University© 2020 IEEE. Natural disasters are a global problem that causes widespread losses and damage. A system to provide timely information is required in order to help reduce losses. Flooding is one of the major natural disasters that requires a monitoring and detection system. The traditional flood detection systems use remote sensors such as river water levels and rainfall to provide information to both disaster management professionals and the general public. There is an attempt to use visual information such as CCTV cameras to detect extreme flooding events; however, it requires human experts and consistent attention to monitor any changes. In this paper, we introduce an approach to the automatic river water level detection using deep learning to determine the water level from surveillance cameras. The model achieves 93% accuracy using a single camera location and 83% accuracy using multiple camera locations.